bellj1674 bellj1674

02-03-2018
Mathematics

contestada

In adding 4/5 + 18/100 the least common denominator is:

Respuesta :

AAAAONNNN AAAAONNNN

02-03-2018

18/100=9/50
4/5+9/50

the least common denominator is 50.

Answer Link

Otras preguntas

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per

help pls :) I am stuck on this chemistry question about percentage yields!

HR contains six red chili beans for green jellybeans and four blue jelly beans if we choose a jellybean then another jellybean without putting the first time ba

What type of stock receives an equal part of the profits on each share to be distributed after all other obligations of a company have been satisfied? A.

a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?

If the [h+] of a 0.205m solution of phenol (c6h5oh) at 25ºc is 2.340 10-6, what is the ka for phenol? phenol is monoprotic.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?

NEED HELP FAST!!! The difference of the values of the third quartile and the median of the data set represented by the box plot is (Pictured Below)

During the cross-bridge cycle, after the calcium binds to troponin, what happens next?