Hazard4292 Hazard4292

04-01-2018
Physics

contestada

Why is saturn's atmosphere almost three times thicker than jupiter's?

Respuesta :

lemickjac lemickjac

04-01-2018

The gravity of Saturn is weaker compared to that of Jupiter and Saturn is less massive

Answer Link

Otras preguntas

According to the United Nations' stages of economic development for classifying countries with respect to levels of industrialization, which category does an in

What did Luther do in 1525 that almost compromised his reputation? PLZZ HELPP!!!!!!

Which statement is not true? O A. Specialized cells are made up of tissues. O B. Body systems are made up of organs. O c. Specialized tissues are made up of cel

In 2017, ABC Company had net sales of $500,000 and a gross margin of $ 300,000. The total overhead costs were $ 100,000 and the promotion costs were $80,000. Th

What element of a crisis management plan defines the process that should unfold once an issue or crisis is identified? Hint: it also includes information about

The robot solves a Rubik’s cube in an average of 20 moves. But it’s correct only 60% of the time .if the robot makes 125 attempts,how many time would you expect

need help on number 4

The width of a rectangle is 4 1/4 inches. The length of the rectangle is 4 times its width. What is the area of the rectangle?

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

please help): I suck at word problems