tinakopilec tinakopilec

02-10-2017
Mathematics

contestada

What is the difference? 405,000,000−1.7×108 2.35 2.35×1072.35×107 2.35×1082.35×108 2.35×1092.35×109

Respuesta :

23briangiberson 23briangiberson

02-10-2017

it would be 2.35×1092.35×109

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which geographic characteristics makes Washington such an important state for international trade? A. It's distance from Canada and Mexico B. It's location on t

What’s the missing side?

-6.8 + (-12) + (-72.3).

Which of the following is a run-on sentence?

It is illegal for a minor to even attempt to purchase alcohol. a. True b. False

Many obstetricians date the onset of pregnancy from the date: select one: a. of conception. b. of the woman's last menstrual period. c. of implantation. d. when

Help! Exponential Equation WITHOUT CALCULATOR

A solution is select one: a. nonuniform. b. homogeneous. c. heterogeneous.

What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2