mcarthurburnett mcarthurburnett
  • 04-09-2017
  • History
contestada

Color photographic film was available to artists in the early 20th century, but many preferred black-and-white film, because

Respuesta :

awesome2012 awesome2012
  • 04-09-2017
they were used to the black and white films
 already
Answer Link

Otras preguntas

Write expression using the distributive property to find the product of 7 times 63
Please help solve, thanks in advance!
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
What does hemostasis mean?
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
What is the sum of 6/10 plus 7/12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5