MrAndrew1502 MrAndrew1502

01-01-2024
Computers and Technology

contestada

A fully equipped site with a short setup time due to restoring data backups and configurations is known as?

Respuesta :

21oizogie 21oizogie

01-01-2024

Answer:

hot computing sites

Explanation:

it is known as hot computing sites

Answer Link

Otras preguntas

How is the creation of public policy in Russia different from that in the United States?

What is let’s read a book in French

An element's atomic number is 64. How many protons would an atom of this element have?

Multivitamin/mineral supplements should never be given to toddlers. a. True b. False

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If you dissolve 14.2 grams of licl in enough water to make 0.450 l of solutions, what is the molarity of the solution?

Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge

Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re

Can you plz help me I don’t know what alliteration I tried searching it up on google but I don’t understand

Simplify the expression completely. x squared over x to the power of 6