kekskdkdkke kekskdkdkke
  • 05-04-2017
  • Mathematics
contestada

The triangles shown below must be congruent. True or false

The triangles shown below must be congruent True or false class=

Respuesta :

shannonroach99
shannonroach99 shannonroach99
  • 05-04-2017
I think it's true lol
Answer Link
Аноним Аноним
  • 05-04-2017
thats true because

the measurements are the same. Congruent means same so therefore it is true
Answer Link

Otras preguntas

The section of the small intestine between the duodenum and ilium?
how do you say theatre in Spanish
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
How much money, in dollars, does one mole of nickels represent?
how do you say theatre in Spanish
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources