aniessa aniessa

03-02-2017
Chemistry

contestada

Will a marble keep rolling forever on a flat hardwood floor?

Respuesta :

Аноним Аноним

03-02-2017

no because friction will sllooow ittttttttt ddooooooooooooooowwwwwwwwn

Answer Link

Otras preguntas

With increasing doses of any useful drug there is usually an increase in the number and severity of

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The length of a rectangular garden is 4 m greater than the width. the area of the garden is nbsp 60m squared . find the dimensions of the garden.

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)

Solve the given inequality and graph the solution on a number line. I need it on a graph -x/2 +3/2 <5/2

When a circular pizza is cut into six slices using diameters, the total length of the cuts is 18 cm. what is the area of the pizza in square centimeters?

^5sqrt4x^2 ^5sqrt4^2

How do you determine the type of ion charge any element will form based on its number of valence electrons?

Which weighs more? a.they both weight exactly the same. b.four protons c.two neutrons and two protons in a helium nucleus?

Find the equation, in point-slope form, of the line that passes -3 and passes through the point (1,2). plz show your work.