Aund0ymonnayres Aund0ymonnayres
  • 03-02-2017
  • Biology
contestada

Vitamins a, d, e, and k are absorbed through the intestinal membrane and stored in the body. these vitamins are also called ____.

Respuesta :

Chrisstina
Chrisstina Chrisstina
  • 03-02-2017
fat soluble
Hopes this helps
Answer Link

Otras preguntas

The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
why did Mr Collins come to the Bennet family looking for a wife?
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
testosterone directly affects the
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a