faythr2 faythr2

03-12-2021
Mathematics

contestada

coffee cost 18.96 for 3 pounds what is the cost per pound of c offee

Respuesta :

deniciasookraj2007 deniciasookraj2007

03-12-2021

Answer:

$18.96 ÷ 3 pounds = 6.32 per coffee

Answer Link

Otras preguntas

Three students are chosen from 6 males and 4 females how many ways are there for mary to go on the trip

Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa

Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

define intrinsic motivation

What law required Northerners to assist in the return of runaway slaves

Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6

How many meters are there in 21 feet?

Which of the following best describes the rights given to the citizens of Jamestown by the Virginia Charter of 1606?

Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi