luisruiz19 luisruiz19
  • 03-09-2021
  • Mathematics
contestada

What can you multiply by 3 and add 2 to get -19?

Respuesta :

spammingallowed
spammingallowed spammingallowed
  • 03-09-2021

Answer:

[tex]let \: the \: unknown \: = x \\ then \: x \times 3 + 2 = - 19 \\ 3x + 2 = - 19 \\ 3x = - 19 - 2 \\ 3x = - 21 \\ x = - 21 \div 3 = - 7 \\ x = - 7 \\ thank \: you[/tex]

Answer Link

Otras preguntas

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
What was George Washington's nickname?
Do all your pet's offspring look the same? If no, then explain why they look different.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
How many years does an apple tree live useful?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?