bulldogd07
bulldogd07 bulldogd07
  • 01-06-2021
  • Mathematics
contestada

Please help the image is attached

Please help the image is attached class=

Respuesta :

Yeetwoops
Yeetwoops Yeetwoops
  • 01-06-2021

Answer:

I tried my best below

Step-by-step explanation:

8. 54

9. 2

Answer Link

Otras preguntas

The root word graph means to _____. speak, write, read
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per
Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new
How did new industrial technologies influence the course of world war i?
Question 16 (5 points)   How are the two angles related? Question 16 options: adjacent complementary supplementary vertical
an integer is one more than four times another. if the product of two integers is 39, then find the integers
which combination of quarks produces a neutral baryon
One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?
How are logos, pathos, and ethos I used in an argument