jazzy2181788
jazzy2181788 jazzy2181788
  • 02-04-2021
  • Mathematics
contestada

Which expression is equal to 45x4-7: 4-2

Respuesta :

Yang100
Yang100 Yang100
  • 03-04-2021

Answer:

173

Step-by-step explanation:

45(4)-7

180-7

173

Answer Link

Otras preguntas

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per
please help if you know, thanks!
What is the difference between a settler an an explorer social studies?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Why is it important for scientists to use blind tests?
Read each verbal expression Then assign a variable and distribute
I need the answer and the path work ok
Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ
describe five ways to set strategy for effectively gathering patients information
Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s