bohanpay
bohanpay bohanpay
  • 02-04-2021
  • Mathematics
contestada

help me in my kevin hart voice

help me in my kevin hart voice class=

Respuesta :

kateyee123 kateyee123
  • 05-04-2021
The answer is 432. You have to go 6*6*12=432
Answer Link

Otras preguntas

What is the domain of the this function?
Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90
Why did the United States go to war with Britain in 1812
A rectangular garden hasblengtg and width as given by thr expression below length 4-7(3x+4y) eifth 3x(-2y) write a simplifird expression for the perimeter of th
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
El clima de la costa Guatemalteca es tropical, es decir es ______________________.
The length of a rectangle is three times its width. If the perimeter of the rectangle is 40ft find it’s area
how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x
How did immigration affect immigrants and other americans in the 1900s?
why is the inner mitochondrial membrane folded