22sierralmuse 22sierralmuse
  • 01-04-2021
  • Mathematics
contestada

Find the equation of the line through point (4,−1) and perpendicular to y=x+2. Use a forward slash (i.e. "/") for fractions (e.g. 1/2 for 12).

Respuesta :

meowmeow223334
meowmeow223334 meowmeow223334
  • 01-04-2021
Perpendicular = opposite sign and reciprocal slope
Y = x + 2 (has slope is 1)
-1/1 = -1
Y = -1x + b
Plug in the point
-1 = -1(4) + b
-1 = -4 + b, b = 3
Solution: y = -x + 3
Answer Link

Otras preguntas

Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
In which system of government would states function independently of each other?
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
Which body tissue or organ contains the most mitochondria?
What were the driving forces behind the industrial revolution
3+1/4x greater than 11
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.