veronicacharles0477 veronicacharles0477

02-03-2021
Mathematics

contestada

can someone pls help with this or drop a link w the answers? ty sm

can someone pls help with this or drop a link w the answers ty sm class=

can someone pls help with this or drop a link w the answers ty sm class=

Respuesta :

Sierrakv717 Sierrakv717

03-03-2021

Answer:

try using the app "photomath" or the website "wolframalpha. c0m"

i feel bad that im not answering any but have a good dayyy! i really hope this helped

Answer Link

Otras preguntas

where are the three parts of an atom located

What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the

Write expression using the distributive property to find the product of 7 times 63

The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the

What are some methods used by Mussolini to rise to power?

In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s

Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea