Seudónimo Seudónimo
  • 02-02-2021
  • Mathematics
contestada

me need help in math

me need help in math class=

Respuesta :

nidiazozaya66
nidiazozaya66 nidiazozaya66
  • 02-02-2021
the answer is d because 42/45 as a percentage is 93
Answer Link

Otras preguntas

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Help pl0x, Algebra 1
How many times does four go into 153 ? What Is the remainder ?
How well did feudalism establish order in the Middle ages?
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
is a centimeter one tenth or one hundredth or a meter