sriver024 sriver024

01-02-2021
Mathematics

contestada

what does one and sixty-three hundredths look like?

Respuesta :

kirstyndouglas kirstyndouglas

01-02-2021

Answer:

1.630

Step-by-step explanation:

Answer Link

Otras preguntas

What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid

A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou

The process through which thoughts and actions become routine is ______.

People and societies in which they live lie outside the biosphere.

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.

the members of an animal community are usually similar in

Four hundred people live on a pacific island and 16 are homozygous recessive for a trait that has only two different types of alleles in the population. how man

Describe these small intestine structures and their functions: intestinal glands -

what is the sum of odd positive integers less than 50

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat