alexaa087 alexaa087
  • 01-12-2020
  • Mathematics
contestada

Use the scatter plot to fill in the missing coordinate of the ordered pair.

Use the scatter plot to fill in the missing coordinate of the ordered pair class=

Respuesta :

akposevictor
akposevictor akposevictor
  • 06-12-2020

Answer:

(16, 6)

Step-by-step explanation:

The coordinate of an ordered pair is often represented as (x, y). That is, when x is equal to a particular value, the value of y would be the corresponding value to x on the coordinate plane.

So, given an incomplete ordered pair, (16, ), to find the missing coordinate, trace the value of y that corresponds to the value of x = 16.

That is, what is the value of y when x = 16.

From the plot, when x = 16, y = 6. The missing coordinate is 6.

Thus, we would have:

(16, 6).

Answer Link

Otras preguntas

What would be the most likely effect of one company buying a competitor?
Why were the committees of correspondence powerful?
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Is 5/7 greater than 4/6
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
what is the most common type of vegetation throughout Latin America
2ln(5x)=8 solve for x