rowsyell rowsyell

01-10-2016
Health

contestada

which organ performs a dual function of ejaculation of sperm and voiding urine

Respuesta :

Аноним Аноним

01-10-2016

The penis in the male does both of these things.

Answer Link

Аноним Аноним

01-10-2016

This organ is called the penis. And it's only found on men.

Answer Link

Otras preguntas

According to the Ajzen model, the strongest predictor of an employee’s behavior is (are):

Helena has five different flowers. She plans to give one flower to each of her five teachers in any order. She gives the first flower to one of her teachers in

I just need a confirmation that my answer is right? Find side AC. Round to the nearest hundredth. The angles are: Angle A = 40°, Angle C = 90°, and Angle B = 50

an integer is one more than four times another. if the product of two integers is 39, then find the integers

Which of the following are considered irregular verbs? Poner and lavar Poner and hacer Bañar and poner Lavar and hacer

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

please answer this im dying here

Separation of ownership and control creates an agency problem when an agent pursues goals that conflict with the principals' goals. Principals establish and use

this is a class called foundation seminar music and math

Your best friend has been feeling sad for more than two weeks, and you are concerned that he may be experiencing depression. How can you have a positive impact