evelynolivares2706 evelynolivares2706

03-10-2020
Mathematics

contestada

The citrus warehouse packed a truck with 1,514 bags of grapefruit. Each bag weighs 5 pounds. What is the total weight of the grapefruit the truck carried?

Respuesta :

zaynah29cfc zaynah29cfc

03-10-2020

Answer: 7750

Step-by-step explanation:

1514 x 5 = 7570

Answer Link

CorgiMaster5 CorgiMaster5

03-10-2020

Answer: 7570 lbs.

Explanation:
There are 1514 bags of grapefruit. If each bag weighs 5 pounds, 1 bag = 5 pounds, then you have to multiply all 1514 bags by 5 to get the total weight.

1514 x 5 = 7570 lbs

Hope this helped! :3

Answer Link

Otras preguntas

Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in

PLEASE HELP ASAP find the quotient of -12x^3 + 21x^2 - 6x/ -3x.-4x^2 - 7x + 184x^2 + 7x + 18-12x^3 + 21x^2 + 24x^2 - 7x + 2

who invented the theory of relativity

What is the distance between points (21, -32) and (-3, -25)?

show work and factor ?

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil

Name all of the traits that the mackerel has, based on this cladogram.

The sterile material that is placed directly on a wound is termed the: