abdullahttttt abdullahttttt
  • 02-09-2020
  • History
contestada

The Umayyad Caliphate was which of the four major Arab Islamic caliphates.

Respuesta :

maddoxgallina2020 maddoxgallina2020
  • 02-09-2020

Answer:

The Umayyad Caliphate was the second of the four major Arab caliphates established after the death of Muhammad. This caliphate was centered on the Umayyad dynasty, hailing from Mecca.

Explanation:

Answer Link

Otras preguntas

Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
31+34=90-n 45+1=70-k 6×9=41+m
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.