zldsoftballgirl107 zldsoftballgirl107

04-05-2020
Arts

contestada

I need help with this in art for my finals

I need help with this in art for my finals class=

Respuesta :

lovaseszterke21 lovaseszterke21

04-05-2020

Answer:b

Explanation:

Answer Link

27080517 27080517

16-12-2020

elements of art = answer to your question

Answer Link

Otras preguntas

describe five ways to set strategy for effectively gathering patients information

How far away is the next Earth-like planet in light years? What does this seem unlikely that it won’t be a manned space mission?

What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15

Describe these small intestine structures and their functions: intestinal glands -

What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Byron uses a poetic technique called _____ to force the reader to _____. A. enjambment; move from one line to the next without pause B. iambic pentameter; pa

List and briefly describe each of the five strength training principles. (Site 1)

What do you think of when you hear the word Renaissance? Write your response in three to four sentences.