daylaindanial29
daylaindanial29 daylaindanial29
  • 03-04-2020
  • Mathematics
contestada

Anyone knows celsius

Anyone knows celsius class=

Respuesta :

TheAnimeGirl
TheAnimeGirl TheAnimeGirl
  • 03-04-2020

so the answer is of option B

Ver imagen TheAnimeGirl
Answer Link

Otras preguntas

You can calculate triangle area when you know all three sides by using Heron's Formula. You can also use a formula discovered by the Chinese which I found in W
find the greatest common divisor of 9 and 27
Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines
Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254
The name for people who stay in one place like civilization of china and kroea
Which English reformer called for change in the church during the 1300's
Which of the following shows the graph of y=In(-2x)
I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou
U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat