samahsulaiman1 samahsulaiman1
  • 04-03-2020
  • English
contestada

Making an exaggerated statement to prove a point is what type of figurative language?

Hyperbole

Simile

Metaphor

Alliteration​

Respuesta :

Nylentine
Nylentine Nylentine
  • 04-03-2020
Hyperbole is your answer
Answer Link

Otras preguntas

How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
x 2 • x 5 answer quick
if f(x)=4x-6, what is f(6)
Can things of aluminum have a greater mass than things made of iron?
Under the articles of confederation, political power and authority ultimately rested with the ________.
Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp
If a solute dissolves in an endothermic process select one: a. hydrogen bonds must exist between solvent and solute. b. strong ion-dipole forces must exist in t
Fractures of the blank of long bones are especially common in young animals
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat