Seudónimo Seudónimo

03-03-2020
Mathematics

contestada

2 numbers sum 120 and product 400

(numbers can be positive or negative)

Respuesta :

Ms4124043 Ms4124043

03-03-2020

2-120*400 is the answer

Answer Link

Otras preguntas

which nutrition provides the highest number of calories per grama)fatb)proteinc) carbohydrated)suger

Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?

Racing other drivers, tailgating, and attempting to beat a train to a railroad crossing are possible consequences of __________ when driving while impaired. A.

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?

the world-systems approach argues that peripheral nations exploit core nations in various ways True or False

Each unit on the map represents 5 miles. What is the actual distance from Oceanfront to Seaside? Question 3 options: about 10 miles about 40 miles about 50 mile

Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall

Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she

Do cones and polyhedrons both have only one base true or false

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat