emilymorris7798 emilymorris7798
  • 02-09-2019
  • Arts
contestada

what is graphic design

Respuesta :

kiki4200
kiki4200 kiki4200
  • 02-09-2019

Answer:

graphic design

Explanation:

it is of computer stuff like computer skills

Answer Link
lexxxxxie
lexxxxxie lexxxxxie
  • 02-09-2019
it is the process of visual communication through the use of typography , photography, and illustration
Answer Link

Otras preguntas

Is the interaction that occurs among elements of the department of defense engaged us government?
What is the distance between 407 squared and negative 68 squared
A man has blood type AB and his wife has blood type B. What are the possible blood types for their child
need help anybody know how to do this
help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute
which of the following harvesting methods is used in large farmhouses a)sickle b)oxen trampling c)combine d)thresher
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
how did world war 2 spur job growth in Washington?A: by decreasing competition in foreign tradeB: by encouraging many people to conserve resourcesC: by increasi
how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8
Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.