alayaaaa566 alayaaaa566
  • 03-06-2019
  • History
contestada

What was the holocast ?

Respuesta :

alexamartin444
alexamartin444 alexamartin444
  • 14-08-2022

Answer: The Holocaust was the systematic murder of Europe's Jews by the Nazis and their collaborators during the Second World War. This programme of targeted mass murder was a central part of the Nazis’ broader plans to create a new world order based on their ideology.

Hope this helped!!

:)

Answer Link

Otras preguntas

Collusive strategies are the third type of cooperative strategies. In many economies, explicit collusive strategies are legal unless otherwise sanctioned by gov
Use the Internet to research current events on healthcare reform. How will proposed healthcare reform impact insurance practices in the pharmacy?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?
how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x
An important change in the american family in the nineteenth century was
What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2
Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed
please answer this im dying here
How did japan gain territory and control of areas of china during world war 1?