Burbie297
Burbie297 Burbie297
  • 02-05-2019
  • Mathematics
contestada

I need help!!!! Answer ASAP!!!!

I need help Answer ASAP class=

Respuesta :

ew69501
ew69501 ew69501
  • 02-05-2019

Answer:

Median

Step-by-step explanation:

Answer Link

Otras preguntas

Are these sentences simple, compound, complex, or Compound Complex?After we get the supplies, we need to draw up plans, and then we will create the project.Lero
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
greater freedom of_at that time than England.​
If 4x = 32, find the value of 35 - 5x 0-5 03 0-3 O 5
Imagina que bas a presentar una exposición en el curso Ciencias sociales. Para planificar tu presentación, responde a estas 3 preguntas ¿Deque quiero ablar? ¿Po
What is the equation of the line that passes through (1, 2) and is parallel to the line whose equation is 2x + y-1=0? 2x - y - 4 = 0 2x + y -4 = 0 2x+y+4= 0
What is the theme of the movie "Smallfoot" and what are some reasoning?
a party rental company has chairs and tables for rent. the total cost to rent 5 chairs and 3 tables is 34. the total cost to rent 7 chairs and 9 tables is 80. w
Please help, What is the nth term rule of the quadratic sequence below? -4,1,12,29,52,81,116
How was Tallahassee chosen as the state capital of Florida