Seudónimo Seudónimo
  • 02-12-2018
  • Mathematics
contestada

What is the equation of the line

What is the equation of the line class=

Respuesta :

Selenafadhil Selenafadhil
  • 02-12-2018

Answer:

y= 1/2x+2

Step-by-step explanation:

y intercept- where the line crosses the y axis (2)


slope (1/2) - rise over run

Answer Link

Otras preguntas

What is the area of the shaded region?
Help me please!! I'll give 16 points
A triangle has sides with lengths of 8 centimeters, 43 centimeters, and 44 centimeters. Is it a right triangle?
How much heat is released when 30g of water at 96 C cools to 25 C
Circle Y is shown. 2 chords intersect. Angle 1 intercepts an arc with measure 37 degrees. Angle 2 intercepts an arc with measure 25 degrees. In circle Y, what
An object has a mass of 10.2 kg, what is its weight in Newton's?
How many acidic protons are there in 0.6137 g of KHP?
Which statement best justifies whether (x-3) is a factor of the polynomial p(x)=x3-3x2-2x-6?
Owo is right PROOF jiskha homework
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'