oleavictoria4
oleavictoria4 oleavictoria4
  • 02-03-2016
  • Mathematics
contestada

what is 1/4(8-6x+12) simplfied

Respuesta :

Exvited
Exvited Exvited
  • 02-03-2016
[tex] \frac{1}{4} (8 - 6x + 12) \\ \\ \frac{1}{4} (-6x + 20) \\ \\ \frac{-6x + 20}{4} \\ \\ [/tex]

The final result is: -6x + 20/4.
Answer Link

Otras preguntas

A mixture from which some of the particles settle out slowly upon standing
What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine
How do the structures of alveoli and capillaries support the function of gas exchange?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A carpenter is making a blanket chest based on an antique chest. Both chests have the shape of a rectangular prism. The length width and height of the new chest
3m2+7=55 answer please
Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?
Write about the formation of Himalayas
In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.
Your religious identity is only important for you within your family and does not matter in the public sphere.